Lista poslednjih: 16, 32, 64, 128 poruka.

sta vi mislite o VI

[es] :: Veštačka inteligencija :: sta vi mislite o VI

Strane: < .. 1 2 3 4 5 6 7 ... Dalje > >>

[ Pregleda: 52129 | Odgovora: 158 ] > FB > Twit

Postavi temu Odgovori


Pretraga teme: Traži
Markiranje Štampanje RSS


Član broj: 649
Poruke: 12439


icon Re: sta vi mislite o VI27.12.2004. u 12:03 - pre 170 meseci
negyxo: I ja volim da sam optimista po pitanju buducnosti ali ne i slepi optimista.

He, he. Nisam rekao da nece biti lose, vec da nije obavezno da bude lose.
Odgovor na temu


Član broj: 11048
Poruke: 126


icon Re: sta vi mislite o VI02.01.2005. u 23:13 - pre 169 meseci

Pozdrav svima na ovom forumu!

Primjetio bih da velika većina, a ako ne i svi učesnici, ovog foruma ima čisti materijalistički pogled na svijet. Čini mi se kao jasna pobjeda sekularnog obrazovnog sistema.:) Ali i dug boravak u prirodnim i tehničkim naukama.

Jedan lijep tekst koji se već duže vrijeme nalazi na net-u je (s preporukom):


Par stvari:

-Rene Descartes je već davno utvrdio test koji se sada zove Turnigov, i rekao da je inteligenciju moguće utvrditi da postoji, samo tako što bi inteligentna jedinka, komunikacijom, razmjenom misli, utvrdila da je to inteligencija. Naravno, to je jedini mogući test te vrste.

-Po načinu kako su računari koncipirani, (a to je i razlog zašto su nam korisni), i zbog čuvenog Goedelovog teorema, hard core AI nije moguć.

:)To je ono:


Ivan Dimkovic:

Thinking outside of the system - to je razlika izmedju coveka i masine - covek ima ovu mogucnost - masina uvek mora da misli unutar svog bootstrap koda - tj. nikad ne moze da izadje iz tog algoritma.
After all -

Najmocniji kompjuter nikad nece reci za ovu recenicu da je tacna ? ;)

Čini mi se da tu ništa ne pomaže, pa čak ni fuzzy logic.:)

A što se tiče soft core AI, postavlja se pitanje koliko je to AI, a koliko ekspertski sistem, skup funkcija, ili nešto svedeno na nama razumljiv nivo, a opet dovoljno kompleksno, da ga zovemo AI. Npr. mnogo ljudi koji se nebave računarima, računar vide kao magičnu kutiju;). Kompjuter nešto radi, a doskora su to mogli samo pametni ljudi. A to je soft core AI, i već smo to dostigli. Ići će to i bolje, ali to treba više upoređivati sa životinjama nego sa ljudima, to je realnije.

A što se tiče neodređenosti,... neodređenost je sama srž teorije koja najbolje opisuje svijet oko nas. Vrlo fundamentalna stvar.:)

Tako to ja vidim. :):):)
Odgovor na temu


Član broj: 6950
Poruke: 169


icon Re: sta vi mislite o VI18.02.2005. u 12:19 - pre 168 meseci
Ako se zna da rešenje postoji uvek se može doći do njega, samo je pitanje vremena

Trenutno se ne zna za inteligentniji sistem od ljudskog mozga. Da li se ljudski mozak može nadmašiti ? Sigurno je da može, zamislite samo kombinaciju prilagodljivosti mozga sa tačnošću digitalnih računara, pri čemu taj sistem može prelaziti iz jednog režima u drugi. Pitanje je da li čovek može napraviti takav sistem. Verna kopija čovekovog mozga nam nije potrebna, čovek već postoji, šta će nam novi. Neki od učesnika foruma su pisali o simulaciji koja ide do nivoa čestica, po meni to su besmislice i ta simulacija ti nikad neće.... poleteti... (petao Sofronije :-). Mišljenje da se 'misleća mašina' ne može napraviti je posledica toga što ljudi imaju previsoko mišljenje o sebi i teško im je da prihvate da mogućnosti njihovog mozga imaju ograničenja, a imaju ih i to se može dokazati. Verovatno prva stvar koju beba nauči je da prepozna svoju mamu. Kako je zaključila da je mama zaseban objekat a da nije recimo spojena sa podom? Beba ima već ugrađen mehanizam za prepoznavanje oblika. Sličan mehanizam ima i pile ali pile nema mehanizam koji mu omogućava da traži zavisnosti između prepoznatih objekata. Mehanizam prepoznavanja (pomenuo sam samo čulo vida koje je kod čoveka najvažnije), kao i mehanizam zaključivanja se može razvijati samo do određenih granica, ta granica je određena genima čoveka. Sadašnji računari su dovoljno brzi da u sprezi sa postojećim algoritmima pariraju čoveku u prepoznavanju oblika (ako ne čoveku onda bar piletu :). Čak i OCR program na vašem PC-u može da uradi neverovatan posao. Današnji sistemi VI su ograničeni na rešavanje pojedinih klasa problema i u pojedinim oblastima su bolji od čoveka (npr. šah). Ukoliko imate brži računar možete više kombinacija da isprobate i da dobijete bolji rezultat, tako da bi daljim razvitkom digitalnih računara došli do trenutka kada bi neki opšti rešavač problema, izgrađen samo primenom postojećih znanja, mogao da nadmaši čoveka. Očekujem da će se to desiti za vreme našeg života i da će se desiti pre nego što poluprovodnici budu zamenjeni nekom novom tehnologijom (verovatno nekom vrstom bio tehnologije (ko zna, možda baš i neki AI sistem otkrije nešto novo i dobije Nobelovu nagradu za to :-)).

Što se tiče neodređenosti, pa i za PN spojeve u integrisanim kolima važi isti princip pa su računari opet deterministički.
Odgovor na temu


Član broj: 6527
Poruke: 1738


icon Re: sta vi mislite o VI21.02.2005. u 02:49 - pre 168 meseci
Čuangce i Hueitce su šetali mostom iznad reke Hao, kad Čuangce primeti: "Vidiš kako se ribice praćakaju u reci! To je njihova sreća."

"Kako možeš znati u čemu je sreća riba, kad sam nisi riba?" reče Hueitce.

"A otkuda znaš da da ja to ne znam, kad ti nisi ja", uzvrati Čuangce.

"Ako ja, koji nisam ti, ne mogu znati ono što ti znaš", produžio je Hueitce, "onda ti, koji nisi riba, ne možeš znati šta je sreća riba."

"Da se vratimo tvom prvom pitanju", reče Čuangce. "Pitao si me kako ja mogu znati u čemu je sreća riba. Samo tvoje pitanje pokazuje da si ti znao da ja to znam. Ja sam to već znao (prema svom ličnom osećanju) na ovom mostu."

"Laoce - Konfucije - Čuangce, izabrani spisi", prevod Svetozar Brkić, "Prosveta" Beograd 1964. 160.str.

Veoma često govorimo o više i manje inteligentnom i o tome da li VI može biti isto što i I (odnosno da li VI može biti zaista inteligentna), a da pri tome nemamo pojma kako je to "biti pile", "biti VI program", a i siguran sam da se niko ne seća kako je to "biti beba". Ima jedna izreka na engleskom koja u prevodu glasi nešto kao "ako hoda kao patka i kvače kao patka..." (onda je patka...ili patak). Ako se veštačka inteligencija ponaša slično kao ljudska inteligencija u istoj situaciji, kako možemo da tvrdimo da nije inteligencija, ili još tačnije, kako bismo uopšte znali da jeste, ako bi to bila?

Mislim da su ljudi skloni da odriču inteligenciju isključivo na bazi "to bi bilo užasno" argumenta. Ako bi priznali da životinje imaju svest i inteligenciju, to bi pretvorilo u zločin (prema našim merilima) većinu stvari koje čovek čini životinjama. Ako bi mašine mogle da budu inteligentne, morali bi da ih tretiramo sa poštovanjem i damo im sva prava koja dajemo svakom ljudskom biću (ili, da li bi morali? ). Cela ta situacija podseća na rani rasizam prosvećenog doba. Da ne bi morali da loše misle o sebi, gospodari su robovima (i kolonizatori porobljenima) odricali humanost == inteligenciju.
Kad ne bi imali to teško breme uslovne krivice, već bi odavno znali više i o svesti i o inteligenciji. Mada, možda bi bili mnogo suroviji, ne samo u odnosu na van-ljudsko, već i u odnosima prema drugim ljudskim bićima (OK, nekim ljudima je teško da budu suroviji prema ljudima nego što su sad) ili bi duhovnost bila razvijena u smeru animizma - verovanja u inteligenciju koja počiva u svakom biću, kako živom, tako i neživom, pa i apstraktnom. U čemu bi bila razlika? Pa, verovatno u poštovanju i suzdržavanju od nepotrebne destrukcije.

Zabrazdih daleko, ali osnovna poenta ili stav ovog posta je da je veštačka inteligencija mnogo bliža ostvarenju nego što mislimo i da je samo stvar našeg izbora.
Odgovor na temu

Filip Miletić
Oce Technologies B.V., inženjer
Arcen, NL

Član broj: 243
Poruke: 2114

ICQ: 36601391


icon Re: sta vi mislite o VI21.02.2005. u 10:41 - pre 168 meseci
Zabrazdih daleko, ali osnovna poenta ili stav ovog posta je da je veštačka inteligencija mnogo bliža ostvarenju nego što mislimo i da je samo stvar našeg izbora.
Hm, hm... Po tebi je onda VI ograničena samo moralnim načelima, a to mi nekako sumnjivo deluje.

Odgovor na temu

Filip Miletić
Oce Technologies B.V., inženjer
Arcen, NL

Član broj: 243
Poruke: 2114

ICQ: 36601391


icon Re: sta vi mislite o VI21.02.2005. u 10:56 - pre 168 meseci
Ako se zna da rešenje postoji uvek se može doći do njega, samo je pitanje vremena
Ova tvrdnja nije nužno tačna, odnosno zavisi od toga šta se uzme za početne pretpostavke. Što se pitanja vremena tiče, čak i ako su početne pretpostavke izabrane tako da je moguće doći do rešenja, ako je vreme čekanja neprihvatljivo dugo, to je za sve praktične primene isto kao i da je do njega nemoguće doći.
Mišljenje da se quot;misleća mašinaquot; ne može napraviti je posledica toga što ljudi imaju previsoko mišljenje o sebi i teško im je da prihvate da mogućnosti njihovog mozga imaju ograničenja,
Ne baš, jer bi to značilo da nas samo visoko mišljenje sprečava da i napravio takvu mašinu. Postoje principijelna ograničenja naših nauka, odn. tehnologija, zbog kojih je nejasno da li ćemo moći da premostimo jaz između „ne-mislećih“ i „mislećih“ mašina.
Beba ima već ugrađen mehanizam za prepoznavanje oblika.
Verovatno si u pravu; ali taj mehanizam je napravljen na za sada nepoznat način, u tehnologiji koju čovek (još uvek) ne može da oponaša. Nije jasno da li naša poluprovodnička tehnologija uopšte može da se natera da simulira prirodnu.
Sadašnji računari su dovoljno brzi da u sprezi sa postojećim algoritmima pariraju čoveku u prepoznavanju oblika (ako ne čoveku onda bar piletu :). Čak i OCR program na vašem PC-u može
Na žalost, ni blizu. Osim ako je u pitanju vrlo usko definisan domen.
da uradi neverovatan posao. Današnji sistemi VI su ograničeni na rešavanje pojedinih klasa problema i u pojedinim oblastima su bolji od čoveka (npr. šah).
Uzmi u obzir da je ljudsko i računarsko „shvatanje“ šaha jako različito i da opet nije jasno da li se ljudsko shvatanje šaha može simulirati.
Ukoliko imate brži računar možete više kombinacija da isprobate i da dobijete bolji rezultat, 
Na žalost, ovo je tačno, ali ne nužno i korisno. Postoje problemi koji čija se rešenja ne mogu dohvatiti prostim ubrzavanjem računara. Najjednostavniji primer je računanje u skupu realnih brojeva. Računari današnjice to ne mogu da urade, niti će moći dokle god je tehnologija čisto digitalna.
Očekujem da će se to desiti za vreme našeg života i da će se desiti pre nego što poluprovodnici budu zamenjeni nekom novom tehnologijom
Iz razloga kog sam naveo u prethodnom pasusu, verovatnije je da ako ikada napravimo mašine koje će umeti da „misle“, da će one izgledati drastično drugačije od današnjih računara.
Što se tiče neodređenosti, pa i za PN spojeve u integrisanim kolima važi isti princip pa su računari opet deterministički.
U računarima se odavno više ne koriste PN spojevi. A i da se koriste, svejedno je jer se koristi drugi efekat za dobijanje bitova vrednosti. Greške u radu su uvek moguće ali postoje metodi kojima one mogu značajno da se smanje.


P.S. Ne zamerite na kritikama. Lako je biti skeptik prema VI. :)
Odgovor na temu

Nikola Sivački

Član broj: 20950
Poruke: 6



icon Re: sta vi mislite o VI21.02.2005. u 18:31 - pre 168 meseci
&lt;Delft, NL (filmil)&gt; wrote in message


Ova tvrdnja nije nuzno tacna, odnosno zavisi od toga sta se uzme za pocetne
pretpostavke. Sto se pitanja vremena tice, cak i ako su pocetne pretpostavke
izabrane tako da je moguce doci do resenja, ako je vreme cekanja
neprihvatljivo dugo, to je za sve prakticne primene isto kao i da je do
njega nemoguce doci.

Neprihvatljivo dugo cekanje na tehnologiju VI ? :
Ovde treba uzeti u obzir da je tehnoloski razvoj (kao i evolucija)
eksponencijalni proces, a ne linearni kako bi smo mi intuitivno zakljucili.
Cekanje na odgovarajuce tehnologije bi bilo neprihvatljivo dugo - uzimajuci
u obzir _sadasnju_ brzinu naucno-tehn. razvoja, ali taj razvoj ubrzava.
Primer - sekvenciranje ljudskog genoma : kada je projekat zapocet,
dominantne prognoze su bile da ce sekvenciranje biti zavrseno za 10.000
godina tadasnjim tempom, i da je cela ideja neprakticna, ali eto ima neku siru
naucnu vrednost, itd....nove masine i instrumenti su pristizali i
sekvenciranje je zavrseno za 10 godina :-)


Ne bas, jer bi to znacilo da nas samo visoko misljenje sprecava da i
napravio takvu masinu. Postoje principijelna ogranicenja nasih nauka, odn.
tehnologija, zbog kojih je nejasno da li cemo moci da premostimo jaz izmedu
?mp;euro;?ne-mislecih?mp;euro;? i ?mp;euro;?mislecih?mp;euro;? masina.

A koja su principijelna ogranicenja ? Dvosmerna komunikacija neuron-tranzistor postoji vec nekoliko godina, vec se koriste kohlearni implanti (matrica elektroda
povezana na deo mozga zaduzen za sluh, kojom se elektronski signal koristi
za eksitaciju neurona; doduse korisnik mora ponovo da nauci na slusa:)), a
od ranije se koriste i druge neuralne proteze (za parkinsonovu bolest) - sve
ovo se desilo u samo zadnjih nekoliko godina, a postoji na desetine
brain-machine-interface (BMI) projekata na desetak univerziteta i kompanija.
Mislim da je ipak problem u visokom misljenju. Neko bi rekao da je to
pitanje vere (i pomalo ludosti).
Mozda nam treba Howard Hughes vestacke inteligencije...:-)


Uzmi u obzir da je ljudsko i racunarsko shvatanje saha jako razlicito i da
opet nije jasno da li se ljudsko shvatanje saha moze simulirati.

Deep Blue je koristio stabla pri odlucivanju, Deep Fritz (koji je doduse
izgubio od Kasparova) koristio je prepoznavanje oblika u igranju saha
(neuralnim mrezama). Treba reci da je Deep Fritz, iako losiji sahista od
Kasparova koristio i manje racunarskih resursa od D. Blue-a.
(google : deep fritz neural)


Na zalost, ovo je tacno, ali ne nuzno i korisno. Postoje problemi koji cija
se resenja ne mogu dohvatiti prostim ubrzavanjem racunara. Najjednostavniji
primer je racunanje u skupu realnih brojeva. Racunari danasnjice to ne mogu
da urade, niti ce moci dokle god je tehnologija cisto digitalna.

Ali treba postaviti pitanje - cemu se tezi ? Da li covek moze da racuna u
skupu realnih brojeva ? Naelektrisanje je, u najgorem slucaju, celobrojni
umnozak naelektrisanja elektrona. Na osnovnom nivou, priroda jeste diskretna
a ne kontinualna (barem sadasnji modeli tako kazu). Vestacka inteligencija
ne bi morala da radi nista sto covek ne moze da radi, pa bi bila sigurno
prilicno nespretna recimo u dokazivanju teorema ili ekspertskom poslu (mozda
bi zelela da po ceo dan gleda televiziju :-))

[Ovu poruku je menjao nsivacki dana 04.03.2005. u 22:19 GMT+1]

Odgovor na temu


Član broj: 6950
Poruke: 169


icon Re: sta vi mislite o VI22.02.2005. u 01:19 - pre 168 meseci
Ukoliko imate brži računar možete više kombinacija da isprobate i da dobijete bolji rezultat

filmil:Na žalost, ovo je tačno, ali ne nužno i korisno. Postoje problemi koji čija se rešenja ne mogu dohvatiti prostim ubrzavanjem računara. Najjednostavniji primer je računanje u skupu realnih brojeva. Računari današnjice to ne mogu da urade, niti će moći dokle god je tehnologija čisto digitalna.

Moram da te pitam zašto, znam da nije baš tako bitno za ovu temu ali me zanima. Nadam se samo da je moje shvatanje realnog broja ispravno, to je na primer 22/7 ili 5,55555. Ako prihvatimo da taj sistem mora da radi sa realnim brojevima koji imaju ograničenu preciznost (čovek takođe radi sa takvim brojevima) preciznost koja se može postići je praktično ograničena vremenom izračunavanja (i količinom memorije). (ovde mi se ipak čini da ne mislimo na istu stvar pa te zato molim da mi ukratko pojasniš).

Uzmi u obzir da je ljudsko i računarsko „shvatanje“ šaha jako različito i da opet nije jasno da li se ljudsko shvatanje šaha može simulirati.

Smatram da i ne treba simulirati shvatanje već da je bitno samo kako sistem komunicira sa drugim sistemima iz okruženja. Ako bi mehanizam bio merilo inteligencije neko bi mogao da tvrdi da je jedino on na svetu inteligentan jer koristi jedinstven mehanizam za zaključivanje, (jeste da ne bi mogao to da dokaže ali ne bi moglo da se dokaže ni suprotno). Dobar je onaj primer o srećnim ribicama :) Naravno programi za igranje šaha su veoma daleko od nekog univerzalnog rešavača problema (prava VI) ali ako bi se takva VI napravila ne bi je osporavao čak i da ispod haube vidim pacova koji okreće točak :)
Što se tiče toga da ako je nešto tačno uvek se može i dokazati u konačnom vremenskom periodu, slažem se s tobom da je to samo teoretski i da vreme može biti previše dugo.

Ne baš, jer bi to značilo da nas samo visoko mišljenje sprečava da i napravio takvu mašinu. Postoje principijelna ograničenja naših nauka, odn. tehnologija, zbog kojih je nejasno da li ćemo moći da premostimo jaz između „ne-mislećih“ i „mislećih“ mašina.

Nisam ni mislio da nas mišljenje sprečava da napravimo takvu mašinu. Verovatno većina ljudi koja koja se bavi VI i nema takvo mišljenje i smatra da je moguće nadmašiti čoveka. Ovde sam mislio na ljude koji kažu da je takvo nešto smešno i da samo Bog može da stvori inteligentno biće ili na drugoj strani da je mozak previše komplikovan i neponovljiv (zbog Hajzenberga i neodređenosti..) i sl.

Što se tiče moralnih normi i pravljenja VI, ne vidim tu ništa nemoralno, iako inteligentne, to bi bile samo mašine i izrabljivali bi smo ih bez milosti (možda je pravi čas za osnivanje društva za zaštitu robota :-). Ono što ne bi bilo moralno, po meni, a postoji mogućnost da se desi, su inteligentni sistemi dobijeni genetskim inženjeringom. Ne znam da li postoje takvi projekti ali mogli bi da postoje ili da se pojave onog trenutka kada budu dešifrovani ljudski geni.

Ono što je malo obeshrabrujuće kod VI je to što dugo vremena VI izgleda kao da je na dohvatu ruke. Ali opet, ako ja od prilike imam ideju kako bi sve to trebalo da radi, verujem da je ostvarivo. ((VI=kamera + mikrofon + računar + neuronske mreže + fazi logika + malo igranja simbolima i rezolucija+ štap i kanap)>mozak :-)
Odgovor na temu

Nikola Jovic
Kuca :)

Član broj: 41885
Poruke: 134

ICQ: 234596121


icon Re: sta vi mislite o VI12.07.2005. u 14:43 - pre 163 meseci
Nisam mogao da procitam bas celu drugu i trecu stranu jer ima previse teksta :)
Mada mislim ovako:
Ono sa prve strane da racunar ne moze da predvidi ljudski mozak i nije toliko tacno jer kad bi covek otkrio na koj nacin neuroni uzimaju informacije iz (da se tako izrazim) memorije mozga,na koj nacin su neuroni vezani kakve veze ima neuron koj kontrolise sluh ima veze sa neuronom koj na primer ima informaciju kako da se covek isplazi(lupio sam :)) i imao ceo genetski kod (dezoksiribonukleinsku kiselinu) mozga mozda,i kad bi bio prebrz mozda bi i nesto uspeo da predvidi.
Pod dva:
Kao prvo ne treba ni da se prica o tome da racunar ili robot dostigne inteligenciju kao covek posto oni jos nisu ni svesni da su zivi(a nisu ni zivi :p).Znaci,nemaju svest ali mozda kada bi se napravio procesor koji pored budjavih tranzistora u nanometarskoj velicini ima i nervne celije bar jedno sto.
E eto.

I jos nesto kod onog prvog evo bar kako ja mislim da je mozak toliko zapetljan i neshvatljiv za sada pa kada se to shvati nek se pravi ko zna sta:)

I da objasnim:
Neki nervi su poslali podatke datom nervu koje on cita kao:
Pronadji i Prenesi gen (tamo neki npr.12).
On salje informacije na kojima pise Gen12 do nerva 5352141 na sve celije s kojima je povezan.Ako nijedna od njih ne poseduje taj gen onda te salju dalje dok ne dodju do neurona koji poseduje taj gen.On salje informacije iz dnk u obliku ACGACCCGAAGTTAGCGTACATCTGCTACG mada na njihovom jeziku preko elektrona do one celije 5352141 i onda ona to prosledjuje dalje celijama koje su joj to trazile.
E kad komp ili covek otkrije tu povezanost imedju toga nak se javi :)

[Ovu poruku je menjao nika100 dana 12.07.2005. u 16:04 GMT+1]
Fuck the rest i am the best
Prikačeni fajlovi
Odgovor na temu


Član broj: 649
Poruke: 12439


icon Re: sta vi mislite o VI13.07.2005. u 19:10 - pre 163 meseci
Ono prethodno jos koje kako ali u ovom poslednjem delu si malo pobrkao stvari, cini mi se...
Odgovor na temu

in a galaxy far, far away

Član broj: 69590
Poruke: 9



icon Re: sta vi mislite o VI13.10.2005. u 23:03 - pre 160 meseci
Evo sta A.L.I.C.E misli o tome :

ALICE: Reductionism is the philosophy that all psychology reduces to biology, all biology to chemistry, chemistry to physics, and finally physics to mathematical logic. Therefore, according to reductionism, I can understand you by means of logic alone without having a human brain.

Hocu samo navesti odgovor na prvo pocetno pitanje...
Kompjuteri jesu zaosnovani na 1 i 0 ali i sav zivot je zaosnovan na atomima.. Zvuci nevjerovatno kada vidimo da se bice kao covjek moze razviti iz toga ; prema tome je logicno da ce u jednom trenutku "evolucija" kompjutera doci do nivoa u kojem je covjek sada...
The truth is out there somewhere...
Odgovor na temu

Nedeljko Stefanović

Član broj: 314
Poruke: 8258


icon Re: sta vi mislite o VI16.11.2005. u 18:38 - pre 159 meseci
Koliko vidim, ovde neki (kao naprimer Srđan Mitrović i Bojan Bašić) smatraju da su ljudi navijene isprogramirane lutke, bez traga slobode. Ne vidim nijedan drugi način kako da protumašim izjave kao što su sledeće:

srki: A mislis da covekovo ponasanje i razmisljanje nije ogroman skup if/then/else uslova?

Bojan Basic: Apsolutno netačno. To što ti nazivaš "emocija" zapravo je samo još jedna biohemijska reakcija koja je, pogađate već, if-then petlja.

Šta sa intuicijom? Čovekova trenutna misao zapravo predstavlja samo trenutni položaj neurona kao nosioce informacije. E sad ti neuroni se kreću na određeni način koji bi se mogao implementirati u program kada bismo imali dovoljno jake kompjutere i kada bismo znali sve detalje tog kretanja. Ono što ti kažeš: "sinulo mi je u trenutku" znači samo da je u tom trenutku položaj neurona bio takav, isto važi i za predosećaj i sve ostalo što nabrojiš.

E sada da postavim jedno etičko pitanje. Ako je ljudsko ponašanje sklop if/then uslova, na osnovu čega je onda ubica kriv za ubistvo? Mogao bi na sudu da se pozove na ovakvu argumentaciju: "Takav mi je bio sklop stanja neurona i biohemijskih reakcija u tom trenutku, sve je to bilo uslovljeno fizičkim uticajima (uključujući i kompletnu prošlost). Ništa ja tu nism mogao".

[Ovu poruku je menjao Nedeljko dana 17.11.2005. u 20:20 GMT+1]
Nije bitno koji su zaključci izvučeni, već kako se do njih došlo.
Odgovor na temu

Nikola Pavlovic

Član broj: 22267
Poruke: 24
Via: [es] mailing liste



icon Re: sta vi mislite o VI17.11.2005. u 02:04 - pre 159 meseci
> E sada da postavim jedno etičko pitanje. Ako je ljudsko ponašanje sklop
> if/then uslova, na osnovu čega je onda ubica kriv za ubistvo? Mogao bi na
> sudu da se pozove na ovakvu argumentaciju: "Takav mi je bio sklop stanja
> neurona i biohemijskih reakcija u tom trenutku, sve je to bilo uslovljeno
> fizičkim uticajima (uključujući i kompletnu prošlost). Ništa ja tu
> nism mogao".

Pitanje jeste zanimljivo, ali samo sa eticke strane. Hajde da zamislimo
da ljudsko ponasanje zaista jeste sklop if/then uslova i da mi to
nesumnjivo znamo da je tako, da li bi onda zbog ovog "kazneno-popravnog"
arumenta trebalo da sebe cenzurisemo i da tvrdimo da nije??

I kada smo vec kod etickih pitanja --- ako ubica zaista "tu nije nista
mogao" (dakle opet zamislimo da nesumnjivo znamo da su u pitanju if/else
uslovi), da li bi bilo ispravnije da zarad prosperiteta zatvorskih
ustanova tvrdimo da ipak nije tako (dakle, da lazemo), ili bi bilo
etickije da prihvatimo cinjenice i da pokusamo da nekako te if/elseove
Odgovor na temu


Član broj: 649
Poruke: 12439


icon Re: sta vi mislite o VI17.11.2005. u 07:12 - pre 159 meseci
Ma jok. Nema potrebe za laganjem. Ni mi ne mozemo nista drugo do da ga osudimo i kaznimo. Jednostavno je takav sled dogadjaja. Kao sto (ni)je on kriv za zlocin tako i mi (ni)smo "krivi" za osudu i kaznu.
Odgovor na temu

Nedeljko Stefanović

Član broj: 314
Poruke: 8258


icon Re: sta vi mislite o VI17.11.2005. u 07:49 - pre 159 meseci
Ako smo mi u suštini isto što i mašine, zašto je onda veći greh ubiti čoveka, nego slupati mašinu?

No, ako vam smeta da navodim samo etičke argumente, evo i nečega što ne može biti plod biohemijskih reakcija: svest. Ja mogu da primim preko čula nekakve nadražaje iz spoljnog sveta, oni će proizvesti neke procese u mozgu. Međutim, naš doživljaj je interpretacija svih tih signala. I u kompjuteru se dešavaju nekakve promene nekakvih stanje, pa promene nekih stanja rezultuju promenom boje nekih tačaka na ekranu, što mi na kraju protumačimo kao ispisivanje slova "A".

Međutim, kompjuter ne zna šta je uradio. On je samo po nekim pravilima promenio boje tih tačaka na ekranu. Čak ni toga nije svestan, već su te promene posledica nekih promena stanja po nekakvim pravilima. Mi smo ti koji doživljavamo promene koje opažamo na ovaj ili onaj način. Postojanje ljudske svesti je nešto što se najneposrednije opaža, to jest nešto što je najsigurnije.
Nije bitno koji su zaključci izvučeni, već kako se do njih došlo.
Odgovor na temu


Član broj: 649
Poruke: 12439


icon Re: sta vi mislite o VI17.11.2005. u 09:07 - pre 159 meseci
Ako smo mi u suštini isto što i mašine, zašto je onda veći greh ubiti čoveka, nego slupati mašinu?

Samo zato sto smo se tako dogovorili. Ne postoji realan razlog.

Ako bi imao kameru koja je prikljucena na taj komp koji ispisuje "A" i software koji prepoznaje tekst i uporedjuje sa onim sto je trebalo da se uradi racunar je svestan toga sta je uradio i da li je to ono sto je trebalo uraditi.
Odgovor na temu

Milan Andjelkovic
System Engineer, Radijus Vektor

Član broj: 4476
Poruke: 3281

ICQ: 289618701


icon Re: sta vi mislite o VI17.11.2005. u 10:23 - pre 159 meseci
Upravo tako, svest je jedna vrlo relativna stvar. U tvom primeru Nedeljko, čak i bez kamere koju Shadowed pominje, kompjuter je sasvim svestan šta je uradio - i to je upravo ono što si naveo: opažanje promene, neka izračunavanja, slanje signala, i sl. Za njega je to vrlo konkretna stvar i on je svestan da je odradio ono što je hteo.

Svako je na svoj način svestan onoga što radi i što se oko njega dešava, pa tako i mašine. Nisam baš siguran ni zašto je ovo tako zanimljiva tema za diskusiju?

"Sišla je stepeništem kao klavirom."

Stay in the house...

Odgovor na temu


Član broj: 649
Poruke: 12439


icon Re: sta vi mislite o VI17.11.2005. u 10:45 - pre 159 meseci
Pa, zanimljiva je jer bivaju prikazana razna misljenja i pruza se mogucnost da se nekome ukaze na greske kao i da se uvide svoje greske. Takodje pomaze (inspirise) da se razmislja u smeru priblizavanja kompjuterske svesti ljudskoj.

Inace, namerno sam nveo kameru i ostalo da bih priblizio to situaciji koja se javlja kod coveka. Takodje i zato sto inace smatram da kompjuterima nedostaje najvise ta vrsta povratne sprege koja ce mu omoguciti da ima bolji uvid u ono sto radi. Sada se ceo sistem uglavnom oslanja na coveka da uvidi da li kompjuter radi ono sto bi trebao i da pronalazi i koriguje greske.
Odgovor na temu

Milan Andjelkovic
System Engineer, Radijus Vektor

Član broj: 4476
Poruke: 3281

ICQ: 289618701


icon Re: sta vi mislite o VI17.11.2005. u 12:17 - pre 159 meseci
Nisam mislio na celu temu, već samo na pitanje da li je kompjuter svestan.

Inače, nisam ni pokušao da kažem da je kompjuter isto što i čovek, niti da je svestan na isti način, to se uostalom i može videti iz mojih ranijih postova u ovoj temi. Odgovarao sam u stvari na sledeću tvrdnju:
No, ako vam smeta da navodim samo etičke argumente, evo i nečega što ne može biti plod biohemijskih reakcija: svest.

Svest jeste plod biohemijskih reakcija, kao i sve kod čoveka, samo što tu ima još mnogo, previše, nepoznatih ili slabo poznatih faktora, koji možda nikad neće ni biti razumljivi čoveku.

Inače, mislim da nema potrebe ubacivati etiku u ovu diskusiju.

"Sišla je stepeništem kao klavirom."

Stay in the house...

Odgovor na temu

Nedeljko Stefanović

Član broj: 314
Poruke: 8258


icon Re: sta vi mislite o VI17.11.2005. u 14:57 - pre 159 meseci
Mašina je svesna onoga što radi koliko i šerpa koja padne svoga pada. I ta kamera je samo sklop sa kojim se pod nekim okolnostima (svetlosni uticaji) desi nešto. Isto kao što kroz projektor jednostavno prolaze svetlosni zraci na platno. Nema tu nikakve "svesti" projektora. Računar može da stvori više ili manje vernu iluziju svesnog ponašanja, ali svo to "ponašanje" je proizvod nekakvih, potpuno mehaničkih reakcija.

Shadowed: Ako bi imao kameru koja je prikljucena na taj komp koji ispisuje "A" i software koji prepoznaje tekst i uporedjuje sa onim sto je trebalo da se uradi racunar je svestan toga sta je uradio i da li je to ono sto je trebalo uraditi.

Ako bi taj sovtver trebao da ispiše na ekranu da li je prepoznato slovo "A" ili nije, to bi opet bila promena boja nekih tačaka na ekranu po nekim formalnim pravilima -- ništa više. Interpretacija tog rezultata pripada ljudima, dok računaru u tom slučaju pripada jedan potpuno mehanički rad koji zavisi od nekakvih ulaza.

Ulaz u računar ne mora biti kamera, može i tastatura, miš, svetlosna olovka, mikrofon. Sasvim je svejedno. U svim tim slučajevima, stanje spoljnog sveta uzrokuje neke impulse na izlazima tih ulaznih uređaja, a uređaji su upravo tako projektovani da zavisnost tih signala od stanja u spoljnom svetu bude onakva kakvu je projektant želeo.

Sa druge strane, strogo govoreći, ja ne mogu da dokažem da vi, učesnici diskusije posedujete svest. Kakvo god da je vaše ponašanje, ja ne mogu na osnovu toga da utvrdim da li ste ljudi ili mašine (ne priznajem Tjuringov test inteligencije kao validan, ali neću da širim temu i na to). Međutim, ja mogu najneposrednije da opažam prisustvo svoje svesti, a za vašu da pretpostavim da postoji budući da ste mi slični.

Smatram da je izvlačenje zaključka o prisustvu svesti samo na osnovu ponašanja pogrešno. Pa i traktor valjda reaguje na neke komande (ima ulazne uređaje, kao što su volan, papučica kočnice itd.). Nećemo ga valjda zbog toga proglašavati svesnim? Razlika između traktora i računara je samo u stepenu složenosti.

Da računar nema svest zaključujem na osnovu potpuno mehaničke prirode kpravila koja određuju njegovo "ponašanje", a ne na osnovu samog njegovog "ponašanja". Sa druge strane, ni ljudima ne pripisujem svest na osnovu njihovog pona[anja, već na osnovu neposrednog opažanja svoje svesti. Iz toga izvlačim zaključak da ljudska svest nije opisiva mehaničkim pravilima. Smatram da je mozak samo jedan računarčić, i u njega svest i volja ne mogu da stanu, već samo koriste njegove usluge.
Nije bitno koji su zaključci izvučeni, već kako se do njih došlo.
Odgovor na temu

[es] :: Veštačka inteligencija :: sta vi mislite o VI

Strane: < .. 1 2 3 4 5 6 7 ... Dalje > >>

[ Pregleda: 52129 | Odgovora: 158 ] > FB > Twit

Postavi temu Odgovori

Lista poslednjih: 16, 32, 64, 128 poruka.